Tag：clustering
-
Time：2021-1-27
Data developers who don’t understand algorithms are not good algorithm engineers. I still remember that when I was a graduate student, my tutor talked about some data mining algorithms. I was quite interested in them, but I had no choice but to contact them less after work. The disdain chain of data engineers is model […]
-
Time：2020-12-21
Depth clustering of Gaussian mixture variational self encoder based on graph embedding Deep Clustering by Gaussian Mixture Variational Autoencoders with Graph Embedding, DGG Author: karugaji – blog Garden http://www.cnblogs.com/kailugaji/ 1. Introduction This blog post is mainly a summary of the paper “deep clustering by Gaussian mixture variable autoencoders with graph embedding”. This article combines graph […]
-
Time：2020-10-2
Mllib is a machine learning library provided by spark. By calling the algorithm encapsulated by mllib, machine learning applications can be easily constructed. It provides a wealth of machine learning algorithms, such as classification, regression, clustering and recommendation algorithms. In addition, mllib standardizes the API for machine learning algorithms, making it easier to combine multiple […]
-
Time：2020-10-1
This paper mainly implements a machine learning application on spark platform, which mainly involves LDA topic model and K-means clustering. You can learn from this article that: The basic process of text mining LDA topic model algorithm K-means algorithm Implementation of LDA topic model on spark platform Implementation of K-means algorithm based on LDA in […]
-
Time：2020-8-24
Click to watch the big guy share The success of deep learning is based on a large number of clean data and deep models, but the data and models are often not ideal in real scenes, for example, there are many label noises in the data, or considering the reasoning speed of the model, the […]
-
Time：2020-8-20
The notes are reproduced in GitHub project：https://github.com/NLP-LOVE/Introduction-NLP 10. Text clustering As the saying goes, birds of a feather flock together. When people get data, they need to sort out, archive similar data together, and automatically discover the similarity between a large number of samples. This task of archiving according to similarity is called clustering. 10.1 […]
-
Time：2020-8-13
This article starts with the official account number: RAIS, click direct attention. preface This series of articles are the reading notes of “deep learning”. You can refer to the original book and read it together for better effect. Unsupervised learning algorithm It is a kind of unsupervised learning method. It is too abstract. There is […]
-
Time：2020-8-12
We had a wonderful Q & A with Milvus friends online on Tuesday. We also made a complete transcript for the friends who could not participate. Friends who feel tired with too many words can watch the video playback according to what they want to know. [here’s the movie! ] Would you like to join […]
-
Time：2020-8-4
Hello readers, in this article, we try to use sklearn library to compare the implementation and results of K-means clustering algorithm and principal component analysis (PCA) in image compression. The effect of the compressed image is evaluated by the reduction of occupancy and the difference from the original image. The purpose of image compression is […]
-
Time：2020-8-1
Author: Andre YeDeep hub translation team: Meng Xiangjie Many people did not expect that viruses, like other creatures on earth struggling to survive, would evolve or mutate. Just look at the viral RNA sequence fragments carried by bats of human origin. AAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAAGTT … And the RNA sequence of human covid-19 virus was extracted AAAATTAAGGCTTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTT … […]
-
Time：2020-6-19
Machine learning is the core of artificial intelligence (AI) and the fundamental way to make computers have intelligence. This paper sorts out 15 terms commonly used in the field of machine learning, hoping to help you better understand this complex subject involving probability theory, statistics, approximation theory, convex analysis, algorithm complexity theory and other […]
-
Time：2020-5-11
By Andre YeDeep hub translation team: Meng XiangjieMany people didn’t expect that viruses, like other creatures on earth struggling to survive, would evolve or mutate. Just take a look at the RNA sequence of the human virus from bats. AAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAAGTT … And an extract of the RNA sequence of human covid-19 virus AAAATTAAGGCTTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTT … Obviously, […]
