Tag:clustering

  • Chapter 6 spark mllib machine learning (1)

    Time:2020-10-2

    Mllib is a machine learning library provided by spark. By calling the algorithm encapsulated by mllib, machine learning applications can be easily constructed. It provides a wealth of machine learning algorithms, such as classification, regression, clustering and recommendation algorithms. In addition, mllib standardizes the API for machine learning algorithms, making it easier to combine multiple […]

  • Chapter 7 implementation of K-means algorithm based on LDA under spark platform

    Time:2020-10-1

    This paper mainly implements a machine learning application on spark platform, which mainly involves LDA topic model and K-means clustering. You can learn from this article that: The basic process of text mining LDA topic model algorithm K-means algorithm Implementation of LDA topic model on spark platform Implementation of K-means algorithm based on LDA in […]

  • Adaptive defect data, neural network training method in business scenarios

    Time:2020-8-24

    Click to watch the big guy share The success of deep learning is based on a large number of clean data and deep models, but the data and models are often not ideal in real scenes, for example, there are many label noises in the data, or considering the reasoning speed of the model, the […]

  • 10. Hanlp realizes k-means-text clustering

    Time:2020-8-20

    The notes are reproduced in GitHub project:https://github.com/NLP-LOVE/Introduction-NLP 10. Text clustering As the saying goes, birds of a feather flock together. When people get data, they need to sort out, archive similar data together, and automatically discover the similarity between a large number of samples. This task of archiving according to similarity is called clustering. 10.1 […]

  • Unsupervised learning algorithm

    Time:2020-8-13

    This article starts with the official account number: RAIS, click direct attention. preface This series of articles are the reading notes of “deep learning”. You can refer to the original book and read it together for better effect. Unsupervised learning algorithm It is a kind of unsupervised learning method. It is too abstract. There is […]

  • Chat with Milvus (1)

    Time:2020-8-12

    We had a wonderful Q & A with Milvus friends online on Tuesday. We also made a complete transcript for the friends who could not participate. Friends who feel tired with too many words can watch the video playback according to what they want to know. [here’s the movie! ] Would you like to join […]

  • Image compression using k-means clustering and PCA in Python

    Time:2020-8-4

    Hello readers, in this article, we try to use sklearn library to compare the implementation and results of K-means clustering algorithm and principal component analysis (PCA) in image compression. The effect of the compressed image is evaluated by the reduction of occupancy and the difference from the original image. The purpose of image compression is […]

  • Machine learning in biology: genome sequencing using k-means and PCA: how does covid-19 mutate?

    Time:2020-8-1

    Author: Andre YeDeep hub translation team: Meng Xiangjie Many people did not expect that viruses, like other creatures on earth struggling to survive, would evolve or mutate. Just look at the viral RNA sequence fragments carried by bats of human origin. AAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAAGTT … And the RNA sequence of human covid-19 virus was extracted AAAATTAAGGCTTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTT … […]

  • MF Technology: 15 terms commonly used in the field of AI machine learning

    Time:2020-6-19

    Machine learning is the core of artificial intelligence (AI) and the fundamental way to make computers have intelligence. ​ This paper sorts out 15 terms commonly used in the field of machine learning, hoping to help you better understand this complex subject involving probability theory, statistics, approximation theory, convex analysis, algorithm complexity theory and other […]

  • Machine learning in biology: how to use k-means and PCA to sequence covid-19?

    Time:2020-5-11

    By Andre YeDeep hub translation team: Meng XiangjieMany people didn’t expect that viruses, like other creatures on earth struggling to survive, would evolve or mutate. Just take a look at the RNA sequence of the human virus from bats. AAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAAGTT … And an extract of the RNA sequence of human covid-19 virus AAAATTAAGGCTTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTT … Obviously, […]

  • Chat with Milvus (1) Q & a record

    Time:2020-4-3

    We had a wonderful Q & A with friends of Milvus online on Tuesday. We also made a complete text record for the friends who could not participate. Friends who feel tired with too many words can watch the video replay according to what they want to know. [see the film here! ] Would you […]

  • RALM: the application of real-time look like algorithm in wechat

    Time:2020-2-17

    Guest: Liu Yudan, senior researcher of Tencent Organized by: Jane Zhang Source: datafuntalk Produced by: datafun Note: welcome to DataFunTalk’s official account, and watch first-hand original technical articles. Guide: this sharing is a wechat paper published by the team on kdd2019. The long tail problem is a classic problem in the recommendation system, but the […]